IMR
The following protocol summaries are for the generation+sequencing of WGS/metagenome libraries (Illumina NextSeq or PacBio Vega) or PCR amplicons with multiple barcodes (ie: "indices") on either the Illumina MiSeq i100 machine (paired-end mode) of length approx. 400-500 bp (300+300 bp with ~100-200 bp overlap) or of longer reads on the PacBio Vega. It assumes an input of up to 384 (380 samples + 4 PCR controls) for MiSeq or 192 for Vega (190 samples + 2 PCR controls) or NextSeq2000 (92 metagenomes). These protocols are a synthesis of manufacturer's guidelines and our current scientific research and development. They are summarized (primarily amplicon protocols) in the "IMR paper" here below that outlines Microbiome Helper, as well as on our GitHub site for Microbiome Helper, which outlines all the steps to follow for the bioinformatics processing, and on our Protocols.io site conatining the step-by-step wet-lab protocols:
Sample collection issues can be very specific to your sample type (ie: the medium which you are sampling) - many of our IMR projects so far focus on water/soil "environmental" samples or fecal matter. For the former, varying volumes of water are typically collected onto filters or a few grams of soil are collected into tubes and frozen at -20°C or -80°C, preferrably dry without a storage buffers. For the latter, fresh fecal pellets are collected from mice or human stool is sampled and then frozen immediately at -20°C or -80°C (again without buffer). All samples are kept frozen until extraction below. For transcriptomics approaches for environmental, lab culture or biopsy samples (not recommended for stool), samples must be immediately flash-frozen in liquid nitrogen after collection.
DNA/RNA is extracted from the samples using the method/kit appropriate to the specific samples - this may also be a choice you make for your personal samples since you have experience with them, or you may wish to follow our choice extraction methods. There is no general consensus in the literature on choice of kits, other than to say all of them affect the final profiles to some degree and that bead-beating is most probably a must for difficult materials (and/or with Gram+ves and protist cysts) - we have currently evaluated and are using the QIAGEN PowerFecal DNA Kit with mouse pellets and human fecal samples; the QIAGEN PowerSoil DNA Kit for soil particles; and the QIAGEN PowerWater DNA Kit for water filters. We tend to also use the QIAGEN PowerFecal DNA Kit as a general kit for swab and saliva extractions, as it has good inhibitor removal+overall performance, as well as the necessary bead-beating (note that swab samples are notoriously difficult/variable in output due to low biomass). We have also tested various DNA kits for use with human urine without much success due to their low target biomass. We have not yet ventured into RNA kits for metatranscriptomes, but this is something that we will be examining in the near future. Quantification and quality-checks are done (via PicoGreen/Qubit [primarily] and NanoDrop) to verify success. Optional: A gel can be run to verify integrity (generally unnecessary for PCR-only studies, but required for WGS sequencing).
Amplicon fragments are PCR-amplified from the DNA in duplicate using separate template dilutions (generally 1:1 & 1:10) using the high-fidelity Phusion Plus polymerase. A single round of PCR is done using "fusion primers" (Illumina adaptors + indices + specific regions) targeting various sub-regions of the 16S (Bacteria/Archaea), 18S (Eukarya, incl. Fungi) or ITS2 (Fungi only) genes with multiplexing which allows up to 380 samples to be run. Preparation for PacBio Vega is essentially the same, except full-length 16S/18S/ITS fusion primers (PacBio barcodes + specific regions) are used instead. PCR products are verified visually by running on a high-throughput Hamilton Nimbus Select robot using Coastal Genomics Analytical Gels. The PCR reactions from the same samples are pooled in one plate, then cleaned-up and normalized. Up to 380 (Illumina) or 190 (PacBio) samples are then pooled to make one library which is then quantified fluorometrically before sequencing.
| Primer Set Coverages (SILVA TestPrime, 0-2 mismatches)a | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Primer Targets | Region(s) | Forward Primer | Reverse Primer | Source(s) | Archaea | Bacteria | Cyanos | Eukarya | mtDNA | chlDNA |
Standard rRNA targets | ||||||||||
| Universal | V4-V5b | 515FB = GTGYCAGCMGCCGCGGTAA | 926R = CCGYCAATTYMTTTRAGTTT | Parada 2015 / Walters 2015 | 81-93% | 85-95% | 85-94% | 81-94% | 57-77% | 81-93% |
| Archaea-specific | 16S V6-V8 | A956F = TYAATYGGANTCAACRCC | A1401R = CRGTGWGTRCAAGGRGCA | Comeau 2011 | 71-82% | - | - | 0-89% | 0-1% | 0-1% |
| Bacteria-specific | 16S V6-V8 | B969F = ACGCGHNRAACCTTACC | BA1406R = ACGGGCRGTGWGTRCAA | Comeau 2011 | 0-14% | 72-83% | 66-88% | 0-1% | 14-75% | 47-87% |
| Bacteria-specific | 16S V3-V4 | 341F = CCTACGGGNGGCWGCAG | 805R = GACTACHVGGGTATCTAATCC | Illumina / Klindworth 2013 | 0-90% | 83-95% | 71-93% | - | 11-54% | 49-90% |
| Eukaryote-specific | 18S V4 | E572F = CYGCGGTAATTCCAGCTC | E1009R = AYGGTATCTRATCRTCTTYG | Comeau 2011 | - | - | - | 54-92% | 1% | 1% |
| Fungi-specific | ITS2c | ITS86(F) = GTGAATCATCGAATCTTTGAA | ITS4(R) = TCCTCCGCTTATTGATATGC | Op De Beeck 2014 | n/a | n/a | n/a | n/a | n/a | n/a |
| Bacteria-specific | 16S V1-V3d | 27Fmod = AGRGTTTGATCMTGGCTCAG | 519R = GWATTACCGCGGCKGCTG | Kim 2013 / Lane 1985 | - | 73-93% | 44-89% | - | 9-75% | 24-87% |
| Bacteria+Archaea-specific ("EMP") | 16S V4e | 515FB = GTGYCAGCMGCCGCGGTAA | 806RB = GGACTACNVGGGTWTCTAAT | Walters 2015 | 84-96% | 84-95% | 76-92% | 0-19% | 52-89% | 64-89% |
| Cyano-specific | 16S V3-V4f | CYA359F = GGGGAATYTTCCGCAATGGG | CYA781R = GACTACWGGGGTATCTAATCCCWTT | Nübel 1997 | - | 2-5% | 58-88% | - | 1-3% | 35-79% |
| Arbuscular Mycorrhiza (AMF)-specific | 18S V4g | WANDA = CAGCCGCGGTAATTCCAGCT | AML2 = GAACCCAAACACTTTGGTTTCC | Lee 2008 / Dumbrell 2011 | - | n/a | n/a | n/a | n/a | n/a |
Metabarcoding targets (require preamplification) | ||||||||||
| All Metazoans | COI | mlCOIintF-XT = GGWACWRGWTGRACWITITAYCCYCC | jgHCO2198 = TAIACYTCIGGRTGICCRAARAAYCA | Wangensteen 2018 / Geller 2013 | n/a | n/a | n/a | n/a | n/a | n/a |
| Fish | 12S | MiFishU-F = GTCGGTAAAACTCGTGCCAGC | MiFishU-R = CATAGTGGGGTATCTAATCCCAGTTTG | Miya 2015 | n/a | n/a | n/a | n/a | n/a | n/a |
Standard rRNA targets | ||||||||||
| Archaea-specific | Full 16S | Arch21Ftrim = TCCGGTTGATCCYGCCGG | A1401R = CRGTGWGTRCAAGGRGCA | Reysenbach 2000 / Comeau 2011 | 58-91% | - | - | 0-6% | - | - |
| Bacteria-specific | Full 16S | 27F(Paliy) = AGRGTTYGATYMTGGCTCAG | 1492R = RGYTACCTTGTTACGACTT | Paliy 2009 / Lane 1991 | - | 72-83% | 72-87% | - | 42-74% | 65-84% |
| Eukaryote-specific | Full 18Sh | NSF4/18 = CTGGTTGATYCTGCCAGT | EukR = TGATCCTTCTGCAGGTTCACCTAC | Hendriks 1989 / Medlin 1988 | 0-14% | - | - | 82-92% | 2% | 1% |
| Fungi-specific | Full ITS | ITS1FKYO2 = TAGAGGAAGTAAAAGTCGTAA | ITS4KYO1 = TCCTCCGCTTWTTGWTWTGC | Toju 2012 | n/a | n/a | n/a | n/a | n/a | n/a |
Microbial (or mtDNA) genomes and community metagenomes are prepared either using: 1) the Illumina Nextera Flex kit for MiSeq+NextSeq (now called DNA Prep kit), which requires a very small amount of starting material (1 ng) as it is a PCR-based library preparation procedure; or 2) the SeqWell LongPlex & PacBio SMRTbell Prep Kit 3.0 for the Vega, which requires more HMW DNA (90% >7 kb) since it is not PCR-based. For the Illumina method, samples are "tagmented" (enzymatically "sheared" and tagged with adaptors), PCR amplified while adding barcodes, purified using columns or beads, normalized using Illumina beads or manually, then pooled for loading onto the MiSeq or NextSeq. For the PacBio method, the HMW DNA is mechanically sheared (if needed), optionally size-selected, repaired, converted into SMRTbell libraries (covalently closed circles), cleaned-up and normalized, then pooled for loading onto the Vega.
We recently completed our evaluation of multiple RNA-Seq kits with rRNA depletion and have selected the Zymo-Seq RiboFree Total RNA Library kit for the production of sufficiently rRNA-depleted libraries (using universal Bacteria/Archaea + Eukarya removal). Briefly, pure RNA samples are rRNA depleted, then the remaining mRNAs are converted to cDNA in a way that maintains stranded information, tagged with Illumina adaptors+barcodes, PCR amplified, purified using beads, then normalized for pooling + loading onto the NextSeq.
Amplicon samples and small genomes are run on our Illumina MiSeq i100 using 300+300 bp XLEAP chemistry which allows for overlap and stitching togther of paired amplicon reads into one full-length read of higher quality. Output is generally ~30-32 million raw reads and ~20 Gb of sequence = ~75,000 reads per sample for 380 amplicons. Long amplicons and de novo genomes are run on our PacBio Vega using SMRTcells which output roughly 20 Gb of HiFi sequence per cell of variable (long) lengths. For larger metagenomic/metatranscriptomic projects, we run on our Illumina NextSeq 2000 using 150+150 bp paired-end chemistry (on P3 cells usually) generating up to ~1.2 billion raw PE reads and ~360 Gb of sequence.
Details of our amplicon and metagenomics pipelines are available at https://github.com/mlangill/microbiome_helper/wiki, but the following is a summary of the major deliverables clients will receive (analyses will require a "mapping file" from the clients containing any relevant metadata for the study):